gabD [2019-06-19 10:35:42]

succinate-semialdehyde dehydrogenase (NADP), general stress protein

Locus: BSU03910

Isoelectric point: 4.76

Molecular weight: 50.10 kDa

Protein length: 462 aa

Gene length: 1389 bp

Function: utilization of gamma-amino butyric acid

Product: succinate-semialdehyde dehydrogenase (NADP)

Essential: no

Synonyms: ycnH

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of gamma-amino butyric acid
• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)

Gene

Coordinates: 442,950 444,338

Phenotypes of a mutant

• growth defect in the presence of gamma-aminobutyrate PubMed

The protein

Paralogous protein(s)

• YfmT, AldX, AldY, GbsA, PutC, YcbD, DhaS, RocA, IolA, YwdH

Structure

• 3RHH (from from Bacillus halodurans C-125 complexed with NADP, 36% identity, 68% similarity)

Expression and Regulation

Operons

• Genes: gabD
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigB: sigma factor, PubMed, in SigB regulon

  Regulatory mechanism

  • GabR: activation, PubMed, in GabR regulon

  Regulation

  • gabD: induced by stress (SigB) PubMed

• Genes: gabT-gabD
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • GabR: activation, PubMed, in GabR regulon

  Regulation

  • GabD: induced by stress (SigB) PubMed

Biological materials

Mutant

• MGNA-C015 (ycnH::erm), available at the NBRP B. subtilis, Japan
• BKE03910 (gabD::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTGAACATTCCTTTCT, downstream forward: _UP4_TAAAAGAATGCACGCTCCTG
• BKK03910 (gabD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTGAACATTCCTTTCT, downstream forward: _UP4_TAAAAGAATGCACGCTCCTG

Labs working on this gene/protein

• Linc Sonenshein, Tufts University, Boston, MA, USA Homepage

References

Loading